KRISHI
ICAR RESEARCH DATA REPOSITORY FOR KNOWLEDGE MANAGEMENT
(An Institutional Publication and Data Inventory Repository)
"Not Available": Please do not remove the default option "Not Available" for the fields where metadata information is not available
"1001-01-01": Date not available or not applicable for filling metadata infromation
"1001-01-01": Date not available or not applicable for filling metadata infromation
Please use this identifier to cite or link to this item:
http://krishi.icar.gov.in/jspui/handle/123456789/1035
Title: | First Report of banana mild mosaic virus infecting banana in India. |
Other Titles: | Not Available |
Authors: | Selvarajan, R. and Balasubramanian, V. |
Published/ Complete Date: | 2016-06-01 |
Project Code: | Not Available |
Keywords: | INDIA; FIRST RECORD; BANANA MILD MOSAIC ViRUS, NRCB Research paper |
Publisher: | The American Phytopathological Society |
Citation: | 0 |
Series/Report no.: | Not Available; |
Abstract/Description: | Banana is one of the important fruit crops grown in the tropical and subtropical regions in developing countries. Viruses are important constraints to the movement and propagation of plant germplasm, especially for vegetatively propagated crops such as banana and plantain. Four major viruses, Banana bunchy top virus (BBTV), Banana streak viruses (BSVs), Banana bract mosaic virus (BBrMV), and Cucumber mosaic virus (CMV) are known to affect the production in banana and plantain. Viruses of minor importance such as Abaca mosaic virus, Abaca bunchy top virus, Banana mild mosaic virus, and Banana virus X are also reported to occur in banana. We have tested 347 leaf samples showing mild chlorotic streak symptoms during 2013 to 2015 collected from Tamil Nadu, Kerala, Goa, and the research fields of ICAR-National Research Centre for Banana, Tiruchirapalli, India, and disease incidence was estimated to be 0 to 33%. Based on the nature of the symptoms observed (Gambley and Thomas 2001), infection by Banana mild mosaic virus (BanMMV, family Flexiviridae) was suspected. Electron microscopy of symptomatic tissue extracts revealed the presence of filamentous virus like particles approximately 800 nm long. Negative results were obtained using potyvirus group degenerate PCR primers and potyviruses specific antibodies. RT-PCR using total RNA was isolated from leaf tissue by the RNeasy Plant Mini Kit (Qiagen). Primer BanCP1 (5′-GGATCCCGGGTTTTTTTTTTTTTTTTT-3′), which is an oligo (dT) with additional cloning sites at its 5′ end, was used for the reverse transcription step (Teycheney et al. 2005). Virus specific primers, BanMMVCPFP: 5′-ATGGCAACDGGGGAAAAGAAGG-3′ and BanMMVCPRP: 5′-TTAATTATTCAATTTGAGGCTCA-3′ were used for PCR amplification. The coat protein (CP) gene of the BanMMV isolate consisted of 717 nucleotides. The amplicon was cloned in pTZ57R/T vector (Fermentas, USA), sequenced, and deposited in GenBank (Accession Nos. KT780866 and KU378053). The CP gene of the Indian BanMMV isolates were compared with the CP of the published isolates. Sequence of the Indian isolates shared 74.4 to 91.7% nucleotides and 87.3 to 95.7% deduced amino acid similarities with other BanMMV isolates. To further confirm the identification, nucleic acid spot hybridization (NASH) was done using digoxigenin-labeled DNA probe for BanMMV and partial cp gene fragment of 250 bp was generated using PCR-DIG probe synthesis kit as per manufacturer’s instructions. In NASH, RNA extract was spotted and tested from 26 leaf samples exhibiting mild chlorotic streaks. Symptoms which were positive in PCR gave strong signals of hybridization, confirming the presence of BanMMV. To the best of our knowledge, this is the first molecular evidence for the occurrence of BanMMV in banana in India and the genetic variability appears to be high between the Indian isolates and others. This report is the primary step to initiate research on the impact of the virus in banana production and germplasm exchange. |
Description: | Viruses are important constraints to the movement and propagation of plant germplasm, especially for vegetatively propagated crops such as banana and plantain. Leaf samples showing mild chlorotic streak symptoms were collected during surveys in 2013-2015 inTamil Nadu, Kerala, Goa and the research fields of ICAR-National Research Centre for Banana, Tiruchirapalli India. Based on the symptoms observed (Gambley and Thomas, 2001), infection by Banana mild mosaic virus (BanMMV, family Flexiviridae) was suspected. Electron microscopy of symptomatic tissue extracts revealed the presence of filamentous virus like particles approximately 800 nm long. RT-PCR using total RNA was isolated from leaf tissue by the RNeasy Plant Mini Kit (Qiagen). Primer BanCP1 (5'-GGATCCCGGGTTTTTTTTTTTTTTTTT-3'), which is an oligo (dT) with additional cloning sites at its 5' end, was used for the reverse transcription step (Teycheney et al. 2005). Virus specific primers, BanMMVCPFP: 5'ATGGCAACDGGGGAAAAGAAGG3' and BanMMVCPRP: 5' TTAATTATTCAATTTGAGGCTCA 3' were used for PCR amplification. The coat protein (CP) gene of the BanMMV isolate consisted of 717 nucleotides. The CP gene of the Indian BanMMV isolates were compared with the CP of the published isolates. Sequence of the Indian isolate shared 74.4 to 91.7% nucleotides and 87.3 to 95.7% deduced amino acid similarities with other BanMMV isolates. Nucleic acid spot hybridization performed using specific probe has also confirmed the presence of the virus in the infected banana leaf samples but not in the healthy leaf samples. To the best of our knowledge, this is the first molecular evidence for the occurrence of BanMMV in banana in India. |
ISSN: | 0191-2917 |
Type(s) of content: | Research Paper |
Sponsors: | Not Available |
Language: | English |
Name of Journal: | Plant Disease |
NAAS Rating: | 9.81 |
Volume No.: | 100 (6) |
Page Number: | 1-5 |
Name of the Division/Regional Station: | Crop Protection |
Source, DOI or any other URL: | http://apsjournals.apsnet.org/doi/full/10.1094/PDIS-10-15-1117-PDN |
URI: | http://krishi.icar.gov.in/jspui/handle/123456789/1035 |
Appears in Collections: | HS-NRCB-Publication |
Files in This Item:
File | Description | Size | Format | |
---|---|---|---|---|
First Report of Banana mild mosaic virus Infecting Banana in India _ Plant Disease.pdf | 266.31 kB | Adobe PDF | View/Open |
Items in KRISHI are protected by copyright, with all rights reserved, unless otherwise indicated.