General Part-1

Technology Code:-	:	201713952805473
Organization Details...
Subject Matter Division	:	{{smdOb.smdName}}
Organization Name	:	{{orgOb.orgName}} ,{{orgOb.City}}
AICRP name if any (AICRP)	:	All Not Applicable {{aicrpOb.aicrpName}}
Division name if any	:	Crop Protection
Details of Inventors..
Principal Inventor	:	A. Ishwara Bhat
Principal Inventor Designation:	:	Principal Scientist
Principal Inventor Email	:	ishwarabhat.a@icar.gov.in
Principal Inventor Address	:	Principal Scientist ICAR-Indian Institute of Spices Research Marikunnu Post Kozhikode 673012 Kerala
Co-Inventor Name	:	A. Jeevalatha
Co-Inventor Email	:	A.Jeevalatha@icar.gov.in
Technology Name	:	Rapid onsite detection of piper yellow mottle virus infecting black pepper by recombinase polymerase amplification-lateral flow assay (RPA-LFA)
Technology Details..
Major resource	:	All Not Applicable {{majorOb.majreName}}
Minor Subject Classification	:	All Not Applicable {{minorOb.minorName}}
Minor Subject Sub Classification	:	All Not Applicable {{minorOb.minorsubName}}
Technology Group	:	All Not Applicable {{techgroup.tecg_group_name}}
Technology Related To	:	All Not Applicable {{techrela.tr_name}}
Complete Details of Technology:	:
Piper yellow mottle virus (PYMoV) (Genus: Badnavirus; Family: Caulimoviridae) causing stunt disease is a pararetrovirus with a restricted host range infecting black pepper and related species such as betelvine and Indian long pepper. The characteristic symptoms of the disease include chlorotic mottling, vein clearing, small and deformed leaves, shorter internodes, and stunted vines. The primary spread of the virus occurs through the vegetative planting material while the secondary transmission occurs through different species of mealybug and black pepper lace bug. The genome of the virus consists of circular double-stranded DNA of about 7.5 kb in size with four ORFs. As there is no chemical control for the management of the infection, the development of effective diagnostic assays would help in the production of virus-free plants and the removal of infected plants. The currently available diagnostic assays for PYMoV detection are PCR, loop-mediated isothermal amplification (LAMP), real-time PCR, and recombinase polymerase amplification (RPA). But these lab-based assays are time-consuming, need technical expertise and expensive equipment, and are not suitable for on-site detection. The development of simple, rapid, specific, sensitive, and cost-effective detection assays is needed for the identification of virus-free plants for propagation. The combination of RPA assay with lateral flow assay (LFA) overcomes the technical difficulties posed by current detection assays and brings the nucleic acid-based assays to the Point of Care (POC), where the assay can be performed and the result can be visualized in a short time at the user’s place. RPA assay is an isothermal nucleic acid amplification assay introduced in 2006 for the rapid identification of pathogens with high specificity and sensitivity. It is a promising technique due to its minimal sample preparation requirements, low operating temperature (37-42℃), low incubation period, and commercial availability of freeze-dried reagents. In combination with a labeled probe and reverse primer or labeled primer pair, RPA allows real-time, fluorescence-based, or lateral flow-based endpoint detection, based on the nature of labeling applied. In the present study, two rapid assays based on the recombinase polymerase amplification (RPA) coupled with lateral flow assay (LFA) using (i) 6-carboxyfluorescein (FAM) labeled nfo probe and biotin-labeled reverse primer and (ii) FAM labeled forward and biotin-labeled reverse primer was developed for the detection of PYMoV. The assays were performed using TwistAmp DNA amplification reagents and crude extract from the infected plant and mealybug as templates. Both assays were optimized for parameters like concentration of magnesium acetate, temperature, and time. The RPA product was then diluted and applied to the sample pad of a lateral flow device for visualizing the results. The formation of a coloured line at the test line was considered positive for PYMoV. The entire process from sample preparation to visualization of results could be completed in about 30 min. The developed assays were specific and 10 times more sensitive than PCR. The assays were validated using field samples of black pepper and mealybug vectors.
Brief Description of Technology Including Salient Features:
Piper yellow mottle virus (PYMoV) is a pararetrovirus associated with stunt disease in black pepper. As the primary spread of the virus occurs through vegetative propagation, effective diagnostics are required for the production of virus-free plants. Currently, available assays are time-consuming, require expensive equipment, and are not suitable for on-site detection. In the present study, two rapid assays based on the recombinase polymerase amplification (RPA) coupled with lateral flow assay (LFA) using (i) 6-carboxyfluorescein (FAM) labeled nfo probe and biotin-labeled reverse primer and (ii) FAM labeled forward and biotin-labeled reverse primer was developed for the detection of PYMoV. The assays were performed using TwistAmp DNA amplification reagents and crude extract from the infected plant and mealybug as templates. Both assays were optimized for parameters like concentration of magnesium acetate, temperature, and time. The RPA product was then diluted and applied to the sample pad of a lateral flow device for visualizing the results. The formation of a coloured line at the test line was considered positive for PYMoV. The entire process from sample preparation to visualization of results could be completed in about 30 min. The developed assays were specific and 10 times more sensitive than PCR. The assays were validated using field samples of black pepper and mealybug vectors.
Benefits/Utility	:
The virus infection can cause a yield reduction and total decline within 5-7 years of infection. The protocol developed by us can be used for the production of virus-free plants of black pepper rapidly without the need for a sophisticated laboratory. Planting virus-free plants in the field ensures healthy crops without disease which contributes to an increase in productivity.
Precaution With The Technology	:	There is a need to use known positive and known negative samples during testing to ensure that tests have been done properly.
How To Use	:
The test sample of black pepper (50 mg of leaf tissue) is ground in a pestle and mortar containing 500 μl of 0.5 N sodium hydroxide. The homogenate obtained after grinding the sample was collected in an Eppendorf tube and diluted (1:10) with 0.1 M Tris-HCl (pH 8) buffer and used as the template for performing recombinase polymerase amplification-lateral flow assay (RPA-LFA). To perform RPA-LFA, a tube containing freeze-dried reaction pellet is added with 29.5 μl of rehydration buffer, 2.4 μl each of FAM-labeled forward primer (CAAGCCAAGAGACCACAACCGGGAAGGAATC) and biotin-labeled reverse primer (CTAATTTAGTAACAAGATCAGCCGAGATACCTG) primer, 8.2 μl of nuclease-free water. The resulting rehydrated mixture was equally distributed into five PCR tubes to make reactions of 10 μl each and 1 μl of the template (crude extract isolated from the black pepper as explained above) was added. The amplification is initiated by adding 0.5 μl of 14 mM magnesium acetate to each of the tubes followed by their incubation at 39°C in a heat block (or any other equipment that can maintain the set temperature) for 4 min. Then tubes are taken out, mixed well by inverting 8-10 times, spun and incubation continued for another 16 min. The amplified product was detected using Milenia Genline Hybridetect-1 lateral flow strips by diluting 1 μl of the amplified product in 49 μl of HybriDetect Assay Buffer and loading 10 μl of the diluted mixture into the sample pad of the lateral flow strip. The sample pad of the dipstick is then dipped in 200 μl HybriDetect Assay Buffer in a microcentrifuge tube and incubated for 2-10 min for the appearance of the colored test and control lines. The formation of coloured line at the test line indicates that the test sample is positive for PYMoV
Impact, If Adopted	:
The technology ensures the identification of PYMoV-infected and healthy plants of black pepper. The infected plants can be removed and healthy plants can be used for further propagation to produce virus-free plants through tissue culture or stem cuttings. The virus-free plants produced in the nurseries are then used in the main field. The planting of virus-free plants in the field ensures healthy crops without disease which contributes to an increase in productivity.
Social Impact	:
The virus infection can cause a yield reduction of up to 82% depending on the severity of the disease. The protocol developed can be used to identify virus-free plants to be used as mother plants for further production of virus-free plants either through tissue culture or vegetative means. Planting virus-free plants in the field ensures healthy crops without disease which contributes to an increase in productivity.
TargetUsers/Stake holders	:	Diagnostic laboratories and tissue culture laboratories involved in the multiplication of black pepper, farmers, and breeders.
Technology Contact..
Name	:	Director
Email	:	director@spices.res.in,director.spices@icar.gov.in
Phone Number	:	0495-2730294
Fax Number	:	0495-2731187
Address	:	ICAR-Indian Institute of Spices Research,Marikunnu P.O.,Calicut-673012
Keyword for Technology	:	Badnavirus, Polymerase chain reaction, crude extract, diagnosis, sensitivity, Point of Care detection.

Technology Development Details Part-2

Project Details (Through which technology was developed)	:	SERB funded project "Development of on-site detection kits for viruses and oomycetes infecting black pepper (Piper nigrum) (FILE NO. CRG/2021/000292)"
Time of Initiation Technology Development	:	4-2022
Time of Completion Technology Development	:	4-2023
Technology Validated by	:	Within ICAR
Technology Validation Details..
Subject Matter Division	:	{{smdOb.smdName}}
Organization Name(if within ICAR)	:	ICAR-Indian Institute of Spices Research,Calicut
Organization Name(if outside ICAR,Please enter)	:
Year of Validation(YYYY)	:	4-2023
Year of Release/Adoption(YYYY)	:	10-2023
Country	:	India

Applies To(Regional Differentiation)Inform Part-3

Location...
Zone(As per the planning commission)	:	All Not Applicable {{zone.planningzoneName}}
Sub zone(As per the planning commission)	:	All Not Applicable {{zonesub.agroName}}, {{zonesub.Region}}
AgroEcological Zone(NBSS & LUP)	:	All Not Applicable {{agrozone.nbssaerName}}
AgroEcological Sub Zone(NBSS & LUP)	:	All Not Applicable {{agrosubzone.nbssaesrName}}
State Name	:	All Not Applicable {{state.stateName}}
District Name	:	All Not Applicable {{dist.distName}}
Soil Type/Resource Type..
Soil Order	:	All Not Applicable {{soilorder.soilorderName}}
Soil Sub Order	:	All Not Applicable {{soilsuborder.soilsubName}}
Soil great group	:	All Not Applicable {{soilgreat.soilgreatName}}
Soil great sub group	:	All Not Applicable {{soilgreatsub.soilgreatsubName}}
Commodity Details..
Commodity	:	All Not Applicable {{commodity.commodityName}}
Commodity Type	:	All Not Applicable {{commoditytype.commoditytypeName}}
Commodity Name	:	All Not Applicable {{commodityname.commodityName}}

Publication Related To Technology Part-4

Publication Related To Technology Part-4

Research Paper information..

1. Greeshma, M., Bhat, A.I. and Jeevalatha and A. (2023 ). Rapid onsite detection of piper yellow mottle virus infecting black pepper by recombinase polymerase amplification-lateral flow assay (RPA-LFA) , Journal of Virological Methods , 315., 1., Elsevier.