Record Details

Isolation and identification of symbiotic bacterium associated with the entomopathogenic nematode, Heterorhabditis sp. (IISR-EPN 01) from India

KRISHI: Publication and Data Inventory Repository

View Archive Info
 
 
Field Value
 
Title Isolation and identification of symbiotic bacterium associated with the entomopathogenic nematode, Heterorhabditis sp. (IISR-EPN 01) from India
Not Available
 
Creator Rashid Pervez, Revathi J, Eapen S J, Devasahayam S and Jacob T K
 
Subject : entomopathogenic nematode, Heterorhabditis sp., bacteria, Photorhabdus luminescens, ginger
 
Description Not Available
The symbiotic bacterium isolated from entomopathogenic nematode, Heterorhabditis sp. (IISREPN 01) from Kozhikode (Kerala), India and identified through morphological, biochemical and molecular characterization. The morphological characteristics and various biochemical tests were done as per described procedures. DNA was extracted from bacterial isolate (IISR-EPN BC 09). The primers 16 S 5’AGAGTTTGATCCTGGCTCAG 3’ (FORWARD) and 5’ AAGGAGGTGATCCAGCCGCA 3’ (REVERSE) were used for the amplification of the ITS region of the rDNA and purified DNA was sequenced. The phylogenetic relationship were also studied using neighbor-joining and maximum composite likelihood methods. The bacterial isolate was Gram negative, rod shaped, facultative and motile. While, the colony characters were red colour with off white margins, circular, raised and opaque. Biochemical characterization showed that the isolate was positive for citrate utilization, methyl red, urease and carbohydrate fermentation tests and negative for indole production, oxidase and Voges Proskauer tests. However, escullin showed weak reaction. On the basis of morphological, biochemical and molecular characterization, the bacterial isolate was identified as Photorhabdus luminescens subsp. akhrustii. This symbiotic bacterium associated with Heterorhabditis sp. (IISR-EPN 01) which isolated from ginger
rhizosphere from India for the first time. The identification of the symbiotic bacteria would help in a better understanding of the relationship between these two organisms.
Not Available
 
Date 2021-08-11T04:39:07Z
2021-08-11T04:39:07Z
2015-04-01
 
Type Research Paper
 
Identifier Rashid Pervez, Revathi J, Eapen S J, Devasahayam S and Jacob T K 2015. Isolation and identification of symbiotic bacterium associated with the entomopathogenic nematode, Heterorhabditis sp. (IISR-EPN 01) from India. Research Journal of Pharmaceutical, Biological and Chemical Sciences 6(2): 339-343.
0975-8585
http://krishi.icar.gov.in/jspui/handle/123456789/54632
 
Language English
 
Relation Not Available;
 
Publisher Not Available