KRISHI
ICAR RESEARCH DATA REPOSITORY FOR KNOWLEDGE MANAGEMENT
(An Institutional Publication and Data Inventory Repository)
"Not Available": Please do not remove the default option "Not Available" for the fields where metadata information is not available
"1001-01-01": Date not available or not applicable for filling metadata infromation
"1001-01-01": Date not available or not applicable for filling metadata infromation
Please use this identifier to cite or link to this item:
http://krishi.icar.gov.in/jspui/handle/123456789/54632
Title: | Isolation and identification of symbiotic bacterium associated with the entomopathogenic nematode, Heterorhabditis sp. (IISR-EPN 01) from India |
Other Titles: | Not Available |
Authors: | Rashid Pervez, Revathi J, Eapen S J, Devasahayam S and Jacob T K |
ICAR Data Use Licennce: | http://krishi.icar.gov.in/PDF/ICAR_Data_Use_Licence.pdf |
Author's Affiliated institute: | ICAR::Indian Institute of Spices Research |
Published/ Complete Date: | 2015-04-01 |
Project Code: | Not Available |
Keywords: | : entomopathogenic nematode, Heterorhabditis sp., bacteria, Photorhabdus luminescens, ginger |
Publisher: | Not Available |
Citation: | Rashid Pervez, Revathi J, Eapen S J, Devasahayam S and Jacob T K 2015. Isolation and identification of symbiotic bacterium associated with the entomopathogenic nematode, Heterorhabditis sp. (IISR-EPN 01) from India. Research Journal of Pharmaceutical, Biological and Chemical Sciences 6(2): 339-343. |
Series/Report no.: | Not Available; |
Abstract/Description: | The symbiotic bacterium isolated from entomopathogenic nematode, Heterorhabditis sp. (IISREPN 01) from Kozhikode (Kerala), India and identified through morphological, biochemical and molecular characterization. The morphological characteristics and various biochemical tests were done as per described procedures. DNA was extracted from bacterial isolate (IISR-EPN BC 09). The primers 16 S 5’AGAGTTTGATCCTGGCTCAG 3’ (FORWARD) and 5’ AAGGAGGTGATCCAGCCGCA 3’ (REVERSE) were used for the amplification of the ITS region of the rDNA and purified DNA was sequenced. The phylogenetic relationship were also studied using neighbor-joining and maximum composite likelihood methods. The bacterial isolate was Gram negative, rod shaped, facultative and motile. While, the colony characters were red colour with off white margins, circular, raised and opaque. Biochemical characterization showed that the isolate was positive for citrate utilization, methyl red, urease and carbohydrate fermentation tests and negative for indole production, oxidase and Voges Proskauer tests. However, escullin showed weak reaction. On the basis of morphological, biochemical and molecular characterization, the bacterial isolate was identified as Photorhabdus luminescens subsp. akhrustii. This symbiotic bacterium associated with Heterorhabditis sp. (IISR-EPN 01) which isolated from ginger rhizosphere from India for the first time. The identification of the symbiotic bacteria would help in a better understanding of the relationship between these two organisms. |
Description: | Not Available |
ISSN: | 0975-8585 |
Type(s) of content: | Research Paper |
Sponsors: | Not Available |
Language: | English |
Name of Journal: | Research Journal of Pharmaceutical, Biological and Chemical Sciences |
Volume No.: | 6(2) |
Page Number: | 339-343 |
Name of the Division/Regional Station: | Division of Crop Protection |
Source, DOI or any other URL: | https://www.rjpbcs.com/pdf/2015_6(2)/[52].pdf |
URI: | http://krishi.icar.gov.in/jspui/handle/123456789/54632 |
Appears in Collections: | HS-IISR-Publication |
Items in KRISHI are protected by copyright, with all rights reserved, unless otherwise indicated.